Skip to content

pTargeT Sequencing Primer

by Promega
Login to view price.
Size
  • Overview
  • Protocols
  • Specifications
  • Resources
  • The pTargeT™ Sequencing Primer is used to sequence inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410) and only for this vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The primer is supplied at a concentration of 10ng/ul (1.25pmol/ul) in sterile water.

    The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.

  • Certificate of Analysis

    Lookup Certificate of Analysis

    Storage Conditions

    -30C TO -10C

    Use Restrictions

    For Research Use Only. Not for Use in Diagnostic Procedures.