- Overview
- Protocols
- Specifications
- Resources
The pUC/M13 Primers are used to sequence inserts cloned into the M13 vectors and pUC plasmids developed by Messing. The primers are purified by gel electrophoresis or HPLC and supplied in sterile water.
Primer Sequences
- Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
- Reverse (22mer): 5´-d(TCACACAGGAAACAGCTATGAC)-3´
- Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´
Reference
- Messing, J. (1983) Meth. Enzymol. 101, 20–78.
-
Certificate of Analysis
Lookup Certificate of AnalysisStorage Conditions
-30C TO -10C
Use Restrictions
For Research Use Only. Not for Use in Diagnostic Procedures.