Skip to content

pUC/M13 Primer, Forward (24mer)

by Promega
Login to view price.
Size
  • Overview
  • Protocols
  • Specifications
  • Resources
  • The pUC/M13 Primers are used to sequence inserts cloned into the M13 vectors and pUC plasmids developed by Messing. The primers are purified by gel electrophoresis or HPLC and supplied in sterile water.

    Primer Sequences

    • Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
    • Reverse (22mer): 5´-d(TCACACAGGAAACAGCTATGAC)-3´
    • Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´

    Reference

    1. Messing, J. (1983) Meth. Enzymol. 101, 20–78.
  • Certificate of Analysis

    Lookup Certificate of Analysis

    Storage Conditions

    -30C TO -10C

    Use Restrictions

    For Research Use Only. Not for Use in Diagnostic Procedures.