As we approach the Christmas & New Year period, we’d like to notify you of our final date for receiving routine orders to facilitate delivery before the Christmas break as Friday 15th December 2023.
The MyBio Team would like to take this opportunity to thank you for your business and continued support. We look forward to meeting you again in 2024.
The pTARGET Sequencing Primer is designed for sequencing inserts cloned into the pTARGET Mammalian Expression Vector (Cat.# A1410). This sequencing primer hybridizes to the region of the lacZ gene at nucleotides 1367-1344 on the pTARGET Vector. This primer can be used only for sequencing inserts in the pTARGET Vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The sequence of the pTARGET Sequencing Primer is 5'-d(TTACGCCAAGTTATTTAGGTGACA)-3'. It is supplied at a concentration of 10ng/ul (1.25pmol/ul) in sterile water.
